|
Left Crispr |
Right Crispr |
| Crispr ID |
1023084819 |
1023084825 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:36559929-36559951
|
7:36559966-36559988
|
| Sequence |
CCAATTTTATTCTTCTGCCTATG |
CCCACATCATTTATTGAACAGGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 1, 1: 3, 2: 65, 3: 712, 4: 4966} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|