ID: 1023095358_1023095361

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1023095358 1023095361
Species Human (GRCh38) Human (GRCh38)
Location 7:36654726-36654748 7:36654740-36654762
Sequence CCTGCTTATGAGGAATTAGCTGG ATTAGCTGGCCCAGGAGCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 97} {0: 1, 1: 0, 2: 7, 3: 57, 4: 458}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!