ID: 1023108028_1023108033

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1023108028 1023108033
Species Human (GRCh38) Human (GRCh38)
Location 7:36782307-36782329 7:36782327-36782349
Sequence CCTATAACTTCCCTCCTCTGAGC AGCACGGACCACCCCACTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 270} {0: 1, 1: 0, 2: 0, 3: 15, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!