ID: 1023109481_1023109491

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1023109481 1023109491
Species Human (GRCh38) Human (GRCh38)
Location 7:36794938-36794960 7:36794976-36794998
Sequence CCTCCTTCCCCACCATGTGGGAG AATGCCTGGCCTCCCACATCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 323} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!