ID: 1023123620_1023123632

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1023123620 1023123632
Species Human (GRCh38) Human (GRCh38)
Location 7:36934027-36934049 7:36934066-36934088
Sequence CCCAGCAGCTTTGGGTGGCTTCT CTCTGGGAATGAAGCCAAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 70, 4: 925}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!