ID: 1023125621_1023125628

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1023125621 1023125628
Species Human (GRCh38) Human (GRCh38)
Location 7:36951485-36951507 7:36951513-36951535
Sequence CCTTAATCAGTGGTTCTCAATCT GGCCACTGGAACCACCTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 110, 4: 518} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!