ID: 1023153991_1023153995

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1023153991 1023153995
Species Human (GRCh38) Human (GRCh38)
Location 7:37229423-37229445 7:37229476-37229498
Sequence CCAAAATTTGTAAACCAGAATCT ATAGAGAAGGAGACAGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 11, 3: 168, 4: 1552}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!