ID: 1023162587_1023162590

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1023162587 1023162590
Species Human (GRCh38) Human (GRCh38)
Location 7:37311673-37311695 7:37311699-37311721
Sequence CCGTGACACATGCACACCCACAG TGCCCAGTGACAGCTGCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 67, 4: 790} {0: 1, 1: 0, 2: 2, 3: 25, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!