ID: 1023172491_1023172503

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1023172491 1023172503
Species Human (GRCh38) Human (GRCh38)
Location 7:37403384-37403406 7:37403414-37403436
Sequence CCCCCAACTCTGAAAAAAAATCA CCAGGGGTTTGGAGGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 1188} {0: 1, 1: 1, 2: 4, 3: 36, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!