ID: 1023213963_1023213971

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1023213963 1023213971
Species Human (GRCh38) Human (GRCh38)
Location 7:37840969-37840991 7:37841019-37841041
Sequence CCATTAACTCGTCATTTACATTA ACACTCTCCCACCCCAGGACAGG
Strand - +
Off-target summary {0: 3401, 1: 4646, 2: 2884, 3: 2471, 4: 9875} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!