ID: 1023213965_1023213971

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1023213965 1023213971
Species Human (GRCh38) Human (GRCh38)
Location 7:37841001-37841023 7:37841019-37841041
Sequence CCTAATGCTATCCCTCCCACACT ACACTCTCCCACCCCAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 44, 2: 533, 3: 4123, 4: 17225} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!