ID: 1023225050_1023225054

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1023225050 1023225054
Species Human (GRCh38) Human (GRCh38)
Location 7:37960456-37960478 7:37960492-37960514
Sequence CCTCTTTGACGAGGTGCCCTTTA ATGTCAGAAAGAAGCTTGTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!