ID: 1023266364_1023266369

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1023266364 1023266369
Species Human (GRCh38) Human (GRCh38)
Location 7:38410366-38410388 7:38410381-38410403
Sequence CCCAGATGGCAGTGTGGGGCCTG GGGGCCTGAAGCTTGAGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 263} {0: 1, 1: 1, 2: 4, 3: 39, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!