ID: 1023270432_1023270439

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1023270432 1023270439
Species Human (GRCh38) Human (GRCh38)
Location 7:38456255-38456277 7:38456287-38456309
Sequence CCTACACTGCTCCCACCATGAGA CTCCCTAATAGCAGGTCCGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!