ID: 1023282462_1023282470

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1023282462 1023282470
Species Human (GRCh38) Human (GRCh38)
Location 7:38585160-38585182 7:38585212-38585234
Sequence CCCTCACAAGAACCCCATGGCAT GAGGATTCTGAGAATCTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 178} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!