ID: 1023299887_1023299894

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1023299887 1023299894
Species Human (GRCh38) Human (GRCh38)
Location 7:38758852-38758874 7:38758885-38758907
Sequence CCAAAAGGAGTGGCTTTGGAGGG GCTGAACACCTGGAGGTTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 263} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!