ID: 1023305361_1023305365

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1023305361 1023305365
Species Human (GRCh38) Human (GRCh38)
Location 7:38820095-38820117 7:38820120-38820142
Sequence CCTGAGCTCTTCCGTCTTTCATC CCTCATCCAAGCCATCACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 121} {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!