ID: 1023317462_1023317468

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1023317462 1023317468
Species Human (GRCh38) Human (GRCh38)
Location 7:38954492-38954514 7:38954508-38954530
Sequence CCTAGCCAAAACTCTGTCTAAAG TCTAAAGGGGAATTTGAGGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!