ID: 1023320933_1023320939

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1023320933 1023320939
Species Human (GRCh38) Human (GRCh38)
Location 7:38996867-38996889 7:38996888-38996910
Sequence CCCCCACCTTTAATGAATGGACA CAGAGCACATGGAATCTACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 5, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!