|
Left Crispr |
Right Crispr |
Crispr ID |
1023337285 |
1023337288 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:39183573-39183595
|
7:39183591-39183613
|
Sequence |
CCTCTTCCACATTGGGGATTATA |
TTATAACTGGACATGAGATTTGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 2, 1: 36, 2: 310, 3: 2060, 4: 5566} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|