ID: 1023337285_1023337289

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1023337285 1023337289
Species Human (GRCh38) Human (GRCh38)
Location 7:39183573-39183595 7:39183592-39183614
Sequence CCTCTTCCACATTGGGGATTATA TATAACTGGACATGAGATTTGGG
Strand - +
Off-target summary No data {0: 2, 1: 38, 2: 282, 3: 1929, 4: 6189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!