ID: 1023352536_1023352543

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1023352536 1023352543
Species Human (GRCh38) Human (GRCh38)
Location 7:39334785-39334807 7:39334837-39334859
Sequence CCTGTTTTTTCTTCTTCTAGAGA ATACAGAGTTAGGGAGGCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 119, 4: 1432} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!