ID: 1023365388_1023365395

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1023365388 1023365395
Species Human (GRCh38) Human (GRCh38)
Location 7:39458517-39458539 7:39458545-39458567
Sequence CCCACAATCCTTAGCGAGCCCGG GCTCCAGGCTGATGTGCTCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 11, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!