ID: 1023368866_1023368873

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1023368866 1023368873
Species Human (GRCh38) Human (GRCh38)
Location 7:39492080-39492102 7:39492108-39492130
Sequence CCCACCAGGAAAAATCTTACTTG GTCCTCCGGCATAAGGGTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!