ID: 1023377705_1023377715

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1023377705 1023377715
Species Human (GRCh38) Human (GRCh38)
Location 7:39575130-39575152 7:39575171-39575193
Sequence CCCCAGAGCTGGCACAGCCAGAG AGACATTAGACTGAGTGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 47, 4: 368} {0: 1, 1: 0, 2: 1, 3: 7, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!