ID: 1023382678_1023382685

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1023382678 1023382685
Species Human (GRCh38) Human (GRCh38)
Location 7:39623867-39623889 7:39623884-39623906
Sequence CCACCCGGGCGGCGGCGGGGGTG GGGGTGTGTCCGGGCGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 363} {0: 1, 1: 0, 2: 4, 3: 44, 4: 443}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!