|
Left Crispr |
Right Crispr |
| Crispr ID |
1023388943 |
1023388952 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:39688855-39688877
|
7:39688901-39688923
|
| Sequence |
CCACAGGCTTAACAGGAAGCATG |
CAATTGTGGCAGAGGGTGAAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 134, 1: 173, 2: 853, 3: 1207, 4: 1081} |
{0: 1, 1: 25, 2: 200, 3: 1678, 4: 3147} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|