ID: 1023400180_1023400186

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1023400180 1023400186
Species Human (GRCh38) Human (GRCh38)
Location 7:39787009-39787031 7:39787032-39787054
Sequence CCAGGGCCATGGTGGTGTTGAGA GATGGTCAGAGGGGAGAAGTAGG
Strand - +
Off-target summary No data {0: 9, 1: 8, 2: 4, 3: 44, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!