ID: 1023412286_1023412291

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1023412286 1023412291
Species Human (GRCh38) Human (GRCh38)
Location 7:39900167-39900189 7:39900210-39900232
Sequence CCAGATTTTGTTCACAAGAAAAC ATACCCCTACTTGTAAAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 40, 4: 435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!