|
Left Crispr |
Right Crispr |
| Crispr ID |
1023447857 |
1023447859 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:40250798-40250820
|
7:40250839-40250861
|
| Sequence |
CCCTTAAGATGTTGAAGTCATTT |
TTTTTTTTTTTTTTTTAAGACGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 3, 3: 56, 4: 407} |
{0: 1944, 1: 89534, 2: 65843, 3: 89503, 4: 176988} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|