ID: 1023456874_1023456881

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1023456874 1023456881
Species Human (GRCh38) Human (GRCh38)
Location 7:40349056-40349078 7:40349106-40349128
Sequence CCACCCTCCTTCTGTATATCCTC TGATGTTTGCTGGCAAACAATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 10, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!