ID: 1023478648_1023478649

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1023478648 1023478649
Species Human (GRCh38) Human (GRCh38)
Location 7:40608716-40608738 7:40608769-40608791
Sequence CCTTTTGTACTTTAGTACAATAG TTTTACCAATGAGCCAAAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180} {0: 1, 1: 0, 2: 3, 3: 36, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!