ID: 1023485036_1023485039

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1023485036 1023485039
Species Human (GRCh38) Human (GRCh38)
Location 7:40677201-40677223 7:40677222-40677244
Sequence CCAGATGTCCTATCTCTTTCATT TTCGGCCAACTCTACATTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 289} {0: 1, 1: 0, 2: 0, 3: 7, 4: 100}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!