ID: 1023495243_1023495251

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1023495243 1023495251
Species Human (GRCh38) Human (GRCh38)
Location 7:40788132-40788154 7:40788167-40788189
Sequence CCCAGTAGTATTGAGGAGTCATT GGGTATCGTGGAGACCAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101} {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!