ID: 1023525309_1023525312

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1023525309 1023525312
Species Human (GRCh38) Human (GRCh38)
Location 7:41096392-41096414 7:41096429-41096451
Sequence CCTACATAGACACTCTTTTGAAT GAATGATGCCTGGAGTTAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 166} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!