ID: 1023548668_1023548673

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1023548668 1023548673
Species Human (GRCh38) Human (GRCh38)
Location 7:41345489-41345511 7:41345514-41345536
Sequence CCATGTTTCCATTGTCTAATGCT TGGGCGAGTGCTGCATTTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!