ID: 1023581889_1023581892

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1023581889 1023581892
Species Human (GRCh38) Human (GRCh38)
Location 7:41692370-41692392 7:41692412-41692434
Sequence CCTGAGATGTTTACGGTACTATA AGTTCTCTGCAGCAGAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 41} {0: 1, 1: 1, 2: 7, 3: 216, 4: 423}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!