ID: 1023598097_1023598106

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1023598097 1023598106
Species Human (GRCh38) Human (GRCh38)
Location 7:41853682-41853704 7:41853727-41853749
Sequence CCTGCTTCCCTGGGACACCTGAG AGCTTCCCACCACCTTCCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!