ID: 1023609713_1023609720

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1023609713 1023609720
Species Human (GRCh38) Human (GRCh38)
Location 7:41960377-41960399 7:41960424-41960446
Sequence CCCTTCCCAGAAACAATTATCCT ACTACTACTTAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 508} {0: 1, 1: 0, 2: 1, 3: 21, 4: 207}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
24 7:41960377-41960399 CCCTTCCCAGAAACAATTATCCT - 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG +