ID: 1023609714_1023609720

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1023609714 1023609720
Species Human (GRCh38) Human (GRCh38)
Location 7:41960378-41960400 7:41960424-41960446
Sequence CCTTCCCAGAAACAATTATCCTC ACTACTACTTAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 178} {0: 1, 1: 0, 2: 1, 3: 21, 4: 207}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
23 7:41960378-41960400 CCTTCCCAGAAACAATTATCCTC - 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG +