ID: 1023609715_1023609720

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1023609715 1023609720
Species Human (GRCh38) Human (GRCh38)
Location 7:41960382-41960404 7:41960424-41960446
Sequence CCCAGAAACAATTATCCTCAGCT ACTACTACTTAGAAAGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 212} {0: 1, 1: 0, 2: 1, 3: 21, 4: 207}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
19 7:41960382-41960404 CCCAGAAACAATTATCCTCAGCT - 7:41960424-41960446 ACTACTACTTAGAAAGAGGAAGG +
452 2:82371987-82372009 CCAATAAATAATTATCATCATCT - 2:82372462-82372484 AGATGATGATAATTATTTATTGG +