ID: 1023623681_1023623685

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1023623681 1023623685
Species Human (GRCh38) Human (GRCh38)
Location 7:42096278-42096300 7:42096297-42096319
Sequence CCGATGGAGTCAGGGTCCCTAGA TAGAATCCAGAATAGGACGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91} {0: 1, 1: 0, 2: 0, 3: 1, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!