ID: 1023624893_1023624897

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1023624893 1023624897
Species Human (GRCh38) Human (GRCh38)
Location 7:42106196-42106218 7:42106243-42106265
Sequence CCCGCAGTTTCCATGCTGCTCAC CCTCTGAGAGCACAGCCCAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 30, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!