ID: 1023632815_1023632823

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1023632815 1023632823
Species Human (GRCh38) Human (GRCh38)
Location 7:42180513-42180535 7:42180553-42180575
Sequence CCAGCAGAAAGACAAATCAGGTG GTGGAGTGATGGCCTGGAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159} {0: 1, 1: 0, 2: 2, 3: 31, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!