ID: 1023633256_1023633260

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1023633256 1023633260
Species Human (GRCh38) Human (GRCh38)
Location 7:42184063-42184085 7:42184113-42184135
Sequence CCGAGGATTAGATGCGTCACTCA CATGCTAAGCACTCTCTAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 62} {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!