ID: 1023699772_1023699773

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1023699772 1023699773
Species Human (GRCh38) Human (GRCh38)
Location 7:42881693-42881715 7:42881709-42881731
Sequence CCAATATGGCTGAGTTCATCTTG CATCTTGCTTCTAGCCTCACAGG
Strand - +
Off-target summary No data {0: 50, 1: 113, 2: 94, 3: 85, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!