ID: 1023699772_1023699774

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1023699772 1023699774
Species Human (GRCh38) Human (GRCh38)
Location 7:42881693-42881715 7:42881713-42881735
Sequence CCAATATGGCTGAGTTCATCTTG TTGCTTCTAGCCTCACAGGCTGG
Strand - +
Off-target summary No data {0: 46, 1: 91, 2: 97, 3: 55, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!