ID: 1023725431_1023725436

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1023725431 1023725436
Species Human (GRCh38) Human (GRCh38)
Location 7:43138379-43138401 7:43138420-43138442
Sequence CCATTTTAGTTCCTAAAGCACAG GTAAATTAATTAGGAACCACCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!