ID: 1023737616_1023737631

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1023737616 1023737631
Species Human (GRCh38) Human (GRCh38)
Location 7:43248743-43248765 7:43248787-43248809
Sequence CCTGTCCCTCTTCCCCCATCTCC TCCCCCTCCTCATAGTTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 211, 4: 1759} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!