ID: 1023737617_1023737631

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1023737617 1023737631
Species Human (GRCh38) Human (GRCh38)
Location 7:43248748-43248770 7:43248787-43248809
Sequence CCCTCTTCCCCCATCTCCCCGTT TCCCCCTCCTCATAGTTTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 66, 4: 695} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!